Read before use
1, check data with precheck (windows version) tools
2, data from excel, copy and paste data into the input frame
3, data from txt, must tab-seperated, copy and paste data into the input frame
4, specieal and non-English characters such as #, <, >, %, (, ), α are not friendly
5, use point as decimal separator, not comma. e.g. 3.14, not 3,14 as pi
Required

Optional
Figure size
figure width：
figure height:

Fontfamily


triplex DNA

Introduction
A DNA triplex is formed when pyrimidine or purine bases occupy the major groove of the DNA double Helix forming Hoogsteen pairs with purines of the Watson-Crick basepairs. Intermolecular triplexes are formed between triplex forming oligonucleotides (TFO) and target sequences on duplex DNA.
Input data instructions
input a sequence, search if it can form triplex, if yes, plot a figure.
Examples from papers
Triplex: an R/Bioconductor package for identification and visualization of potential intramolecular triplex patterns in DNA sequences Fig 1
Input GGAAAGCAATGCCAGGCAGGG
Output

1) How to plot?
1, Put data in excel according to the example format.
2, Copy and paste into input frame.
3, Input pre-checking button to check input
4, After checking pass, select parameters, submit and download

2) How to cite?
3000+ papers in (Google Scholar)
Tang D, Chen M, Huang X, Zhang G, Zeng L, Zhang G, Wu S, Wang Y. SRplot: A free online platform for data visualization and graphing. PLoS One. 2023 Nov 9;18(11):e0294236. doi: 10.1371/journal.pone.0294236. PMID: 37943830.

3) FAQs