Note: input data format must match the example on the right, tab-seperated
1, data from excel, copy and paste data into the input frame
2, data from txt, must tab-seperated, copy and paste data into the input frame
3, use point as decimal separator, not comma. e.g. 3.14, not 3,14 as pi

Required
input data:


Optional
Figure size
figure width:
figure height:

Fontfamily


triplex DNA

Introduction
A DNA triplex is formed when pyrimidine or purine bases occupy the major groove of the DNA double Helix forming Hoogsteen pairs with purines of the Watson-Crick basepairs. Intermolecular triplexes are formed between triplex forming oligonucleotides (TFO) and target sequences on duplex DNA.
Input data instructions
input a sequence, search if it can form triplex, if yes, plot a figure.
Examples from papers
Triplex: an R/Bioconductor package for identification and visualization of potential intramolecular triplex patterns in DNA sequences Fig 1
Input GGAAAGCAATGCCAGGCAGGG
Output

1) How to plot?
1, Prepare data
2, Open with excel, and change into the same format as the example
3, Copy and paste data into the input frame
4, Select parameters
5, Submit and download figure files

2) Why NO figure generated?
Script need strigent input format, please read the instructions and examples carefully.

3) How to cite?
2000+ papers in (Google Scholar)
Tang D, Chen M, Huang X, Zhang G, Zeng L, Zhang G, Wu S, Wang Y. SRplot: A free online platform for data visualization and graphing. PLoS One. 2023 Nov 9;18(11):e0294236. doi: 10.1371/journal.pone.0294236. PMID: 37943830.

4) FAQs