Note: input data format must match the example on the right, tab-seperated
1, data from excel, copy and paste data into the input frame
2, data from txt, must tab-seperated, copy and paste data into the input frame

Required
input fasta format:


Operation
complementary
reverse
reverse complementary

DNA --> RNA
RNA --> DNA

to lower
to upper

output only names
remove gap

only output sequences whose lengths less than
max length (-1 for all)
only output sequences whose lengths larger than:
min length (-1 for all)

format output
how many bases per line (if 0, all sequence in one line)

Order
by name (natural order)
by sequence length (short -> long)
by sequence length (long -> short)

shuffle sequence
shuffle seed

This tool will consume 0 Points

Fasta sequence operation

FASTA and FASTQ are basic and ubiquitous formats for storing nucleotide and protein sequences. Common manipulations of FASTA/Q file include converting, searching, filtering, deduplication, splitting, shuffling, and sampling. Existing tools only implement some of these manipulations, and not particularly efficiently, and some are only available for certain operating systems. Furthermore, the complicated installation process of required packages and running environments can render these programs less user friendly. https://bioinf.shenwei.me/seqkit/
Input
>ENSMUSG00000020122
CCCTCCTATCATGCTGTCAGTGTATCTCTAAATAGCACTCTCAACCCCCGTGAACTTGGT
TATTAAAAACATGCCCAAAGTCTGGGAGCCAGGGCTGCAGGGAAATACCACAGCCTCAGT
TCATCAAAACAGTTCATTGCCCAAAATGTTCTCAGCTGCAGCTTTCATGAGGTAACTCCA
GGGCCCACCTGTTCTCTGGT
>ENSMUSG00000020123
GAGTCAGGTTGAAGCTGCCCTGAACACTACAGAGAAGAGAGGCCTTGGTGTCCTGTTGTC
TCCAGAACCCCAATATGTCTTGTGAAGGGCACACAACCCCTCAAAGGGGTGTCACTTCTT
CTGATCACTTTTGTTACTGTTTACTAACTGATCCTATGAATCACTGTGTCTTCTCAGAGG
CCGTGAACCACGTCTGCAAT
Output basic statistics
output by different functions.

1) How to plot?
1, Prepare data
2, Open with excel, and change into the same format as the example
3, Copy and paste data into the input frame
4, Select parameters
5, Submit and download figure files

2) Why NO figure generated?
Script need strigent input format, please read the instructions and examples carefully.

3) How to cite?
162 papers cited us (Google Scholoar). You can cite the original package, or using the following format:
Heatmap was plotted by http://www.bioinformatics.com.cn, a free online platform for data analysis and visualization.

4) FAQs